Adapters for the preparation of DNA libraries for Illumina NGS
Sequencing random fragments of DNA is possible via the
addition of short nucleotide sequences which allow any DNA fragment to:
1. Bind to a flow cell
for next generation sequencing
2. Allow for PCR
enrichment of adapter ligated DNA fragments only
3. Allow for indexing
or 'barcoding' of samples so multiple DNA libraries can be mixed
together into 1 sequencing lane (known as multiplexing)
During library preparation each DNA fragment gets and
addional A overhang added to both ends.
The sequencing adapters are the following:
# TruSeq
Universal Adapter:
5
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3
# TruSeq
Indexed Adapter
5 P*GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
3
The stars indicate a phosphorothioate bond between the last
C and T to prevent cleaving off the last T that is needed for annealing
the overhang. The phosphate group on the indexed adapter is required to
ligate the adapter to the DNA fragment.
The NNNNNN in the indexed adapter above represents the
barcode. Reverse the indexed adapter and note how the last 12 bases are
complementary.
Diagram of an adapter
P5 and P7 : Flow cell attachment sites
ID : Index
Adapter : Sequencing primer binding sites
DNA fragment : Insert
Frequently Asked Questions (FAQ)
How can I quickly find a adapters product?
To find a adapters product, use the search function by name, product code, supplier, brand or sub-category. You can also browse the product families listed on the page to identify an available product code, an alternative or an equivalent product.
Does Biovalley stock several product codes in the adapters category?
Yes, Biovalley distributes several product references in the adapters category, sourced from specialist suppliers. Depending on the product family, references may vary in terms of format, packaging, brand, supplier, technical specifications or availability.
Can I request a quote for adapters products?
Yes, you can request a quote for adapters products from the product page or by contacting Biovalley (info@biovalley.fr). To help us process your enquiry, please provide, where possible, the product name, catalogue reference, required quantity, the supplier or brand you are looking for, and the country of delivery.
How can I find out if a adapters product is available to order?
The availability of a adapters product depends on the product code, supplier, packaging and country of delivery. For up-to-date information, please check the product details page or contact Biovalley with the product code or name of the product you are looking for.
What should I do if I cannot find the adapters product I am looking for?
If the adapters product you are looking for does not appear in the catalogue, please contact Biovalley with the available information: product name, reference number, supplier, brand, format or packaging. The team will be able to search for the reference number within its network of suppliers or suggest an available alternative.
Are all adapters products available under the same terms and conditions?
No. Ordering, delivery, storage and documentation conditions may vary depending on the product type, the supplier and the applicable regulations. Certain product codes may require specific approval, specialised transport, a safety data sheet or additional information prior to ordering.
Search result : 46 product found
Refine your search :
RUO
CE/IVD
NEW
- kit 28
- pcr products 10
- Other products 8
- PCR 26
Cat#
Description
Cond.
Price Bef. VAT
‹
›