ADGB (NM_024694) Human 3' UTR Clone

Référence SC203160

Conditionnement : 10ug

Contactez votre distributeur local :


Téléphone :

ADGB (NM_024694) Human 3' UTR Clone

Be the first to review this product
SKU
SC203160
3' UTR clone of chromosome 6 open reading frame 103 (C6orf103) for miRNA target validation
 
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ADGB
Synonyms C6orf103; CAPN16
ACCN NM_024694
Insert Size 275 bp
Sequence Data
Insert Sequence
>SC203160 3’UTR clone of NM_024694
The sequence shown below is from the reference sequence of NM_024694. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGAAAAAAAAGAAAGGAAAGAAAAAGTAACCAGGGGATGTCCAATACTACCCTGCTTCTGGAGAGAAA
AAATCTATTTGTAATGATCTTTAACTGCCTGCTGTTAAGATATTAGGCCAAATGAAAATAGAAATTTCT
CTTTCTTAGAAATATTTTAATGCTAACTTGTTAGTTTTCCTCAGAAAGCTAGTATTTGAAGCCATTTGA
GTTTAAGATGCTCTAATTTCAATAAAATAGCTTCCAAATATTTAATAAAATATGTTTGACACTCTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024694.4
Locus ID 79747
MW 10.3

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.