ASC1 (TRIP4) (NM_016213) Human 3' UTR Clone

Cat# SC203164

Size : 10ug

Contact local distributor :


Phone :

ASC1 (TRIP4) (NM_016213) Human 3' UTR Clone

Be the first to review this product
SKU
SC203164
3' UTR clone of thyroid hormone receptor interactor 4 (TRIP4) for miRNA target validation
 
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ASC1
Synonyms ASC-1; ASC1; HsT17391; MDCDC; SMABF1; ZC2HC5
ACCN NM_016213
Insert Size 269 bp
Sequence Data
Insert Sequence
>SC203164 3’UTR clone of NM_016213
The sequence shown below is from the reference sequence of NM_016213. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGTTAATGAAGCAGAATAAAGCTGTCTGACCCAGGAGAAAAGGAACTATACAGCATAGTGGAGTTTTG
TGTACTAAAATTGCTATCTACTGGTCCTTTGGAATTGAAGTAGTAGAAACCTAAAGGCTTGGCGTCAGG
CTTGAATATCTCAGAACTTAAACTCTTACCAAAATCTGTATATTTTTCTTAAGGAGTGGGATTCCTACT
TTATGTAATGGGGTCGAAATCTTTGAACACATTATTTATAAAAACCTGTTTAAAAATTCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016213.5
Locus ID 9325
MW 10.2
Summary This gene encodes a subunit of the tetrameric nuclear activating signal cointegrator 1 (ASC-1) complex, which associates with transcriptional coactivators, nuclear receptors and basal transcription factors to facilitate nuclear receptors-mediated transcription. This protein is localized in the nucleus and contains an E1A-type zinc finger domain, which mediates interaction with transcriptional coactivators and ligand-bound nuclear receptors, such as thyroid hormone receptor and retinoid X receptor alpha, but not glucocorticoid receptor. Mutations in this gene are associated with spinal muscular atrophy with congenital bone fractures-1 (SMABF1). provided by RefSeq, Apr 2016

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.