Cfap161 Mouse qPCR Primer Pair (NM_029335)

Cat# MP213208

Size : 200reactions

Contact local distributor :


Phone :

Cfap161 Mouse qPCR Primer Pair (NM_029335)

Be the first to review this product
SKU
MP213208
qSTAR qPCR primer pairs against Mus musculus gene Cfap161
 
Specifications
Product Data
Locus ID 75556
Forward Sequence GCCAAGTGGTTGTCTATGGGCA
Reverse Sequence CCTCATCTGTCAGAGTCACCTC
ACCN BC061016, NM_029335, NM_029335.1, NM_029335.2, NM_029335.3, BC048079
UniProt ID Q6P8Y0
Synonyms 1700026D08Rik; AW047638; AW551802
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products