GMPPA (NM_205847) Human 3' UTR Clone

Cat# SC203149

Size : 10ug

Contact local distributor :


Phone :

GMPPA (NM_205847) Human 3' UTR Clone

Be the first to review this product
SKU
SC203149
3' UTR clone of GDP-mannose pyrophosphorylase A (GMPPA) transcript variant 2 for miRNA target validation
 
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol GMPPA
Synonyms AAMR
ACCN NM_205847
Insert Size 221 bp
Sequence Data
Insert Sequence
>SC203149 3’UTR clone of NM_205847
The sequence shown below is from the reference sequence of NM_205847. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGAAGCTTCACCAACCAGATCATCCTCTGAGTAGGGCTGCCAGAAGGCCCCCAGCTCCTACCCACTCCC
CTTGAGGCTGCTGCCTGCTTGGCCAGCCTCTGTCCAGAAAGGACCAGAGAAAGCCAGGCTGGATCGTCA
CATGCCGGGGAGCAATGTGGATGGCCTGGGGACTCCTGGGTTTTCTCCCTCCCGACTCCCTAATAAACC
CCGTGAACCTTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_205847.3
Locus ID 29926
MW 7.8
Summary This gene is thought to encode a GDP-mannose pyrophosphorylase. This enzyme catalyzes the reaction which converts mannose-1-phosphate and GTP to GDP-mannose which is involved in the production of N-linked oligosaccharides. provided by RefSeq, Jul 2008

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.