TRM1 (TRMT1) (NM_017722) Human 3' UTR Clone

Cat# SC200021

Size : 10ug

Contact local distributor :


Phone :

TRM1 (TRMT1) (NM_017722) Human 3' UTR Clone

Be the first to review this product
SKU
SC200021
3' UTR clone of TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) (TRMT1) transcript variant 1 for miRNA target validation
 
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol TRM1
Synonyms MRT68; TRM1
ACCN NM_017722
Insert Size 58 bp
Sequence Data
Insert Sequence
>SC200021 3’UTR clone of NM_017722
The sequence shown below is from the reference sequence of NM_017722. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGGCTGCCGCTGGGCCAGGCATAGACTGAACCAATAAAGAGATGTCACGTCACCTTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_017722.5
Locus ID 55621
MW 1.9
Summary This gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The encoded enzyme has both mono- and dimethylase activity when exogenously expressed, and uses S-adenosyl methionine as a methyl donor. The C-terminal region of the encoded protein has both a zinc finger motif, and an arginine/proline-rich region. Mutations in this gene have been implicated in autosomal recessive intellectual disorder (ARID). Alternative splicing results in multiple transcript variants encoding different isoforms. There is a pseudogene of this gene on the X chromosome. provided by RefSeq, May 2017
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products